Single Site Gateway Cloning

Learn how to simulate Gateway® cloning in Geneious Prime, including how to automatically design attB-linked oligonucleotide primers, simulate BP and LR reactions.

Introduction

Geneious Prime provides all of the tools required for primer design and in silico simulation of Gateway® cloning.

Thermo Fisher Scientific describe their Gateway® Technology as “a universal cloning method that takes advantage of the site-specific recombination properties of bacteriophage lambda to provide a rapid and highly efficient way to move a gene of interest into multiple vector systems.” See the Thermo Fisher Scientific website for a full description of Gateway® cloning.

To express a gene of interest using Gateway the following steps are taken:

  1. Generate an entry clone by performing a BP recombination reaction between a pDONR™ vector and an attB PCR product or expression clone.
  2. Generate the desired expression clone by performing an LR recombination reaction between the entry clone and a Gateway® destination vector.
  3. Introduce your expression clone into the host system of choice for expression of your gene of interest.

Watch the video or follow the steps below

Perform BP and LR reactions, design primers to amplify your sequence, incorporate AttB sites, and simulate a one-step Gateway reaction.

Primer design rules overview

Thermo Fisher Scientific recommend that to enable efficient Gateway® cloning, primers for addition of attB sites MUST contain the following structure:

  • Four guanine (G) residues at the 5′ end of each primer, followed by a 25 bp attB site, and followed by At least 18-25 bp of template/gene-specific sequence
  • The attB1 site should end with a thymidine (T)
  • If you plan to express native protein in E. coli or mammalian cells, you may want to include a Shine-Dalgarno or Kozak consensus sequence, respectively, in your PCR primer
  • If fusing your sequence in-frame with an N-terminal tag, the forward (attB1) primer must include two additional nucleotides to be in-frame with the attB1 region. The two nucleotides cannot be AA, AG, or GA, as these additions will create a termination codon
  • If fusing your sequence in-frame with an C-terminal tag, the reverse primer must include one additional nucleotide to be in-frame with the attB2 region. If you do not want to perform a C-terminal fusion you must include a stop codon

When the Geneious Primer design tool is used to add att extensions to primers it will automatically do the following:

  • Add four 5′ guanine (G) nucleotides
  • Add the specified att motif to your primers
  • End the attB1 with a T “ACAAGTTTGTACAAAAAAGCAGGCT
  • Add a 2 nucleotide “TA” spacer to forward attB1 primers†
  • Add a 1 nucleotide “T” spacer to reverse primers†

† In Geneious Prime 2019.1 and earlier “spacer” nucleotides are added as part of the att motif annotation. In future versions of Geneious Prime the “spacer” nucleotides will be added as separate annotations.

The primer design tool will not add translation initiation motif sequences. Users will need to add these motifs manually as extensions during the primer design process.

The primer design tool will not add a stop codon to a reverse primer. If you require a stop codon you should incorporate a template-derived stop codon (if present) or manually add a stop codon as an extension during the primer design process.

Design Primers for Gateway Cloning

In this exercise we will design oligonucleotide primers to amplify the mature xynB CDS.

The forward and reverse primers will be designed to incorporate attB1 and attB2 sites respectively, to allow clonase-mediated integration of the PCR product into a Gateway entry vector. The primers will be designed to both have a first-round melting temperature (Tm) of 55°C.

The primers will be designed to precisely amplify the mature xynB CDS (no signal sequence) to ensure that when the xynB CDS is transferred into the pDest17 destination vector it will be positioned for in-frame fusion to the vector start codon and associated HIS-tag sequence. This will ensure optimal transcription and expression of the XynB gene product. The xynB CDS stop codon will be included to ensure correct termination of the gene product.

To start select the DTU76545 sequence to view it.

Click on the yellow xynB mature CDS annotation to select the mature CDS region (positions 139 to 1149). (If the xynB mature CDS annotation is not visible then click on the ‘yellow arrow’ icon in the Sequence View side panel and check the option to Show Annotations.)

With the xynB mature CDS annotation selected, click the Primers button on the Toolbar and choose Design new primers.

In the Design New Primers setup window:

  • Click on the cog icon in the bottom left corner of the Window and choose to Reset to Defaults
  • Ensure Select Task: is set to Design New
  • Ensure the Forward Primer and Reverse Primer options are checked
  • Set Task: to Precise
  • Ensure the Included Region: option is checked and the range is set to 139 to 1149
  • Set Number of pairs to generate to 1

We will design primers with a melting temperature of around 55°C so we need to changes Tm Min: default settings:

  • set the Tm Min: / Optimal: / Max: values to 50 / 55 / 60

To add Gateway extensions to the primers, expand the Advanced section of the Setup window, then click on the 5′ Extensions: Fwd: button, click the Gateway site… button and from the drop down menu choose Site: attB1.

Click OK, and you will see that the extension will comprise 4 G nucleotides and an attB1 site. The G nucleotides are added to ensure the clonase enzyme can efficiently bind to the terminal aatB1 site.

For the reverse primer, click the Rev: button, click the Gateway site… button and from the drop down menu choose to add an “antisense” attB2 site.

Click to run the Primer design tool and two new annotations, 139 F and 1149 R will be added to the sequence. Hit Save (Command or CTRL-S) to save the new annotations.

Hover over each primer sequence and you will see a tool tip containing information about the primer.

The next step is to generate a PCR product sequence. Select the DTU76545 file, click on the Primers button and choose Extract PCR Product. The tool will detect the new forward and reverse primer annotations on the sequence and select them. In the dialog that opens, confirm the Forward and Reverse primers are correctly selected, then hit OK.

A new DTU76545 PCR Product sequence will be created. Select it and you should see it has inward facing attB1 and attB2 sites positioned and oriented correctly for a BP clonase reaction.

We will use this PCR product in the next Exercise.

If you plan to routinely design Gateway Primers then you can save your ideal primer design settings by clicking on the cog icon in the bottom left corner of the Design New Primers window and choose to Save current settings. You can load these settings next time by clicking on the cog icon and choosing Load Profile.

To extract your primers to individual files select each primer_bind annotation and Hit the Extract button. You can use these extracted sequences for ordering from your oligo synthesis service provider.

Simulate “BP” Entry Clone Reaction

In this exercise we will simulate a BP clonase reaction between our new PCR product and a donor vector with appropriate attP1 and attP2 sites.

Select the pDONR221 sequence to view it. You will see this vector has attP1 and attP2 sites flanking a chloramphenicol (cmR) resistance gene and a ccdB toxin gene. This region will be replaced by recombination with the PCR product to create an entry vector.

To perform the BP clonase reaction, select the pDONR221 and DTU76545 PCR Product sequences then go Cloning → Gateway Cloning. The Gateway cloning tool will identify the att sites present on both the vector and the PCR product insert, confirm they are appropriately oriented, and inform that a BP reaction will be performed.

Hit OK and a new sequence called pDONR221 – DTU76545 PCR Product Entry clone will be created. This new 3558 bp sequence represents the expected entry plasmid generated by the clonase reaction. You will see that the clonase reaction has created flanking attL1 and attL2 sites suitable for use in a clonase-mediated LR-reaction.

The pDONR vectors manual recommends that individual E. coli colonies containing your clonase-derived constructs are checked by PCR using the M13-F (-20) and M13-R primers. Binding sites for these primers are present and annotated onto the pDONR221 vector. We will now use the Extract PCR Product tool to simulate this PCR reaction so that we can determine the size and sequence of the predicted product.

Select the new pDONR221 – DTU76545 PCR Product Entry clone, Hit the Primers button and choose Extract PCR product. Set the Forward primer to M13-F (-20) and the Reverse primer to M13-R (-26). This will create a 1303 bp PCR product sequence.

Simulate “LR” Destination Clone Reaction

In this exercise we will simulate a LR clonase reaction between our new pDONR221 – DTU76545 PCR Product Entry clone and the destination vector pDEST17 vector.

Select the pDEST17 sequence to view it. You will see this vector has attR1 and attR2 sites flanking a chloramphenicol (cmR) resistance gene and a ccdB toxin gene.

To perform the BP clonase reaction, select the pDEST17 and pDONR221 – DTU76545 PCR Product Entry clone sequences then go Cloning → Gateway Cloning. The Gateway cloning tool will identify the att sites present on the entry vector and Destination vector and confirm an LR reaction can be performed. In the test tube an LR reaction creates two new plasmid species. The Gateway tool will output both plasmids if you wish. The tool will ask if you want to “keep both products of the reaction”. In this exercise leave this option unchecked so only the final Expression vector will be created.

The tool will confirm sites in each vector are appropriately oriented, and inform that a LR reaction will be performed.

Hit OK and a new 5713 bp plasmid called pDEST17 – pDONR221 – DTU76545 PCR Product Entry clone Expression clone will be created.

The new file name, although descriptive is a bit long and cumbersome. Select the file in the document table, click on the file name to edit it and rename the file to pDEST17:xynB mature.

As a last step we will check that our insert is in-frame with the vector start codon and HIS-tag.

Select the renamed pDEST17:xynB mature sequence, ensure Translation is turned on in the Display tab, then zoom in so that you can see the initiation ATG annotation at the 5′ end of the xynB mature CDS annotation. Click on the xynB mature CDS annotation to select it, then drag the left hand boundary of the annotation to extend it to line up with the first “A” of the start codon. You will see in the translation that the start codon and HIS-tag are in-frame with the translated start of the xynB mature CDS “QTSI…”.

Note that changing annotations on a sequence with actively linked parents will break the linkage. When you adjust the xynB mature CDS annotation boundary you will get a warning about Actively linked parents. You can ignore this warning and click Continue Editing, just remember to not save the document when asked, or alternately, use menu File → Save As to save an unlinked copy of the original document.

Single Step BP and LR Reactions

To simplify your Gateway reactions it is possible to use the Gateway cloning tool to perform the BP and LR reactions in a single operation. Simply select your PCR product insert with attB sites, your pDONR vector and your pDest vector and go Cloning → Gateway Cloning.

To try cloning in one step, select the DTU76545 PCR Product, the pDONR221 vector and the pDEST17 vector and go Cloning → Gateway Cloning.

The Gateway cloning tool will confirm the selected sequences can be “reacted” and will ouput the same final 5713 bp expression plasmid.

Prepare Gateway Vectors

The Thermo Fisher Scientific website provides the sequences for their Gateway vectors. However they are not available in a useful annotated form.

If you obtain and import an unannotated Gateway vector sequence then you can use the Geneious Annotate from: tool to identify and annotate various features onto the sequence. For more information see the Transferring annotations tutorial on Geneious Academy.

The Geneious Gateway cloning tool requires that Gateway vectors and inserts are annotated with special att annotations. For example, an attR1 motif should be annotated with an annotation of Type: AttR1 and Name: attR1.

To add correct att annotations to your vector sequences, select your new vector sequence and go Cloning→Annotate att sites.

If you receive an annotated Gateway sequence that appears to have att annotations, but it is not accepted by the Gateway cloning tool then double check each att annotation and ensure the correct Type is set.

If you are unsure if the att annotations are correct then select and delete them then use the Cloning→Annotate att sites operation to identify and add the appropriate att site annotations to your sequence.

More Geneious Academy

Watch this video series to learn the basics of Gateway cloning and how to simulate single or multisite Gateway cloning.
Practice simulating multisite Gateway cloning. Choose attB sites, design primers, and simulate BP and LR reactions.
Practice how to import, design and test oligonucleotide primers, primer-pairs and primer-pair/probe combinations.
Use the Transfer Annotations tool to transfer features to a reference or consensus sequence in an alignment or assembly.
Get started with Geneious today